The
Facility offers a wide range of DNA sequencing services, all using our state-of-the-art
highly automated platform.
Find
out the right procedure and order frms to order an analysis
DNA
genotyping services using state-of-the-art highly automated platform
Listed
questions ans answers frequently asked, pertaining to our services
| SEQUENCING |
| You
provide |
| • template |
purified plasmids |
| bacterial colonies for plasmid extraction |
| purified PCR samples |
| unpurified
PCR samples |
| • sequencing primers |
| Options |
| • quality |
standard: no individual quality control of sequence reads included |
| premium: individual quality control of sequence reads is
included. Failed sequences are repeated once when failure can be due
to mistakes during our experimental procedures |
| • read lenght |
short run: 750 bp read, on average 550 bp, no minimum.
Recommended for sequencing PCR products. |
| long
run: 1000 bp read, on average 800 bp, no minimum.
Recommended for plasmid sequencing. |
| We deliver |
| • Single
read sequence |
| • Data: raw (ABI files), analysed (text files), quality
scores |
| • Data transfert via secured website (https) or attached
te email |
| • Time schedule for |
standard
quality: 36 hours |
| premium
quality: 2 to 5 days |
| 24
hours service (delivered before 3 P.M.) |
| Prices** |
| |
templates in individual tubes |
templates
in plate format* |
| standard quality |
short run |
8 euro |
6 euro |
| long run |
9 euro |
7 euro |
| premium quality |
short run |
10 euro |
8 euro |
| long run |
11 euro |
9 euro |
* A plate format is defined as a 96 well sample plate with : Primers
delivered in the same plate format as the templates (this can be within
the same plate as the templates). At least 8 templates per plate
(organized per column). Only one template type (PCR/plasmid) per
plate or column.
** Special
prices for academic users on request. Discounts are awarded depending on
the number of samples per year. |
| name |
sequence |
explanation |
| M13FS |
TGTAAAACGACGGCCAGT |
M13 Forward |
| M13RS |
CAGGAAACAGCTATGACC |
M13 Reverse |
| SP6 |
TATTTAGGTGACACTATAG |
SP6 primer |
| T7 |
TAATACGACTCACTATAGGG |
T7 primer |
| T7term |
TATGCTAGTTATTGCTCAG |
T7 terminator |
| T3 |
ATTAACCCTCACTAAAGGGA |
T3 promotor |
Check
out the universal sequencing primers that we keep available to our customers,
free of charge.
•
All prices are VAT exclusive (+ 21 %)
• The customer will be charged for each run unless in the event a failure being
our fault.
• Check out our template and primer submission guidelines.
• We also offer purification services for PCR-products and plasmids.
